Analogy and Homology

1.     Two species that contain a homologous trait are humans and monkeys.  Humans have tailbones and monkeys have tails, which are homologous of each other.  The structure of the bone is similar, yet humans have very small tails that do not have a function hence why it is called the tailbone and monkeys do.  This trait exhibits differences between the two species as monkeys have visible tails that have functions and humans do not.  Humans do not need the extra limb. Monkeys use their tails for many functions like grabbing and holding on to things.  I would conclude that the common ancestor would be a primate that could be within the Anthropoidia infraorder.

                                                                               Monkey Tail:

  

Human Tailbone:

2.     Sharks and dolphins have an analogous set of traits.  They both have fins, yet sharks originate from the fish family while dolphins are in the mammal family. The use of the fin with both species is to help the animal swim.  Both the fins of a shark and a dolphin protrude from the body and have a similar structure of a flipper.  Dolphins had to adapt to their environment in order to survive.  Dolphins and sharks do not have a common recent ancestor.  The two species share from the same kingdom and phylum but have different classes.  The common ancestor could not have possessed this analogous trait because the common ancestor was the Vertebrata Ubphylum, but then the classes split mammals from reptiles, amphibians, and fishes.  The shark developed the fins under the fish class, while dolphins developed the fin much later on through adaptation.  We know these traits are analogous because dolphins do not have family history of fins.  Dolphins had to adapt to its environment in order to survive.

                                                                         Dolphin Fins:

                                                                          Shark Fins:

Some information found other than from the textbook at:

http://jayabiofiji.edublogs.org/2013/07/11/comparative-anatomy-shark-vs-dolphin/

Images found on Google

Protein Synthesis DNA Strand

CTAATACAATCATAGTCAAGAGCTTCACGTGATATGAATCGTAG

Georges Cuvier

1.     One of Charles Darwin’s biggest challenger was Georges Cuvier who denied the idea of evolution.   Cuvier, the founder of comparative anatomy, developed the idea of extinction as well as was adamant about “the fixity of species.”  Instead of staying in line with Darwin, Cuvier came up with the idea of catastrophism, where the reason things were so different in the past was not because we have evolved, but because there was catastrophic events that completely changed Earth. 

http://www.pbs.org/wgbh/evolution/library/02/1/l_021_01.html

2.     The sixth bullet point says “If the environment changes, the traits that are helpful or adaptive to that environment will be different.” The works of Cuvier negatively affected this bullet point as he was sure God placed each species on Earth for a specific purpose and were unchangeable.  Cuvier completely disagreed with the idea of evolution and the thought of traits being adaptive.  Also, the eighth bullet point which states “in order for traits to evolve and change, the must be heritable” was affected by Cuvier’s ideas.  Darwin based a lot of his opinion around the influences of Cuvier’s claims and what he took out of Cuvier’s work.  Cuvier’s findings discovered fossils that were very much different than the bones of humans and species today.  And though Cuvier came to the idea of catastrophism, Darwin approached the findings as evidence to evolution and the idea of traits being adaptable and heritable. 

3.     Though I do believe Cuvier impacted natural history and the development of the theory of evolution, Darwin could have developed the theory of evolution without Cuvier’s impact as he discounted much of Cuvier’s claims and theories.  Many of the findings and evidence Darwin encountered were similar to Cuvier’s, yet interpreted differently.  I also believe the idea of extinction was something Darwin as well as many other scientists could have developed on their own using their own work.

4.     During the Middle Ages, the Church’s teachings reigned supreme.  Since evolution and natural selection went against the teachings of the Church, the price for “challenging God’s perfection” was high.  Darwin was threatened with being prisoned or even death.  At first, Darwin was hesitant to publish.  But soon, Darwin published his work including the book, On the Origin of Species, well aware of the high stakes. 

If I were stranded on a desert island, I would take with me a flint-stone and a knife.  I would use the flint-stone to create fire.  I can use the fire to keep warm, boil water, cook raw meat, and scare away predators.  I would bring a knife to kill my prey including fish and other animals for food and protection.  A knife is also useful for building things like breaking off branches and leaves of trees to make a shelter.